Volume 5, Issue 4 , Pages 303-307, August 2011
Establishing the pangolin mitochondrial D-loop sequences from the confiscated scales
Article Outline
- Abstract
- 1. Introduction
- 2. Materials and methods
- 3. Results and discussion
- 4. Conclusions
- Acknowledgements
- References
- Copyright
Abstract
Pangolin scales are encountered in traditional East Asian medicines (TEAM) and the ever increasing demand for these scales has escalated the decline in the numbers of these mammals. The identification of protected pangolin species is necessary to enforce international and national legislation as well as assist with conservation measures. There is limited morphological feature on a pangolin scale thus requiring DNA analysis as a means of identification. We report on the isolation of DNA from pangolin scales and a strategy for obtaining the full length of the mitochondrial D-loop, being 1159
bp. Primer sets creating five overlapping amplicons were designed to amplify sections of this mitochondrial DNA locus. DNA from the blood stain of nineteen Formosan pangolins (Manis pentadactyla pentadactyla) along with 145 scale samples that were suspected to have come from pangolins, was amplified and sequenced; leading to a total of 91 D-loop sequences being obtained. The 19 Formosan pangolin sequences produced 5 haplotypes and 72 of the 145 seized scales provided useable sequence classified as a further 38 haplotypes. The D-loop sequences from those scales suspected to be from a pangolin had a higher similarity to any of the 19 samples taken from M. p. pentadactyla compared to a D-loop sequence from Manis tetradactyla (the only pangolin D-loop sequence in GenBank, NC_004027). These 43 haplotypes were used to establish a local database for the D-loop sequence of pangolins and add to the data of Manis sp. held on GenBank. The PCR amplification strategy development in this study could be used in forensic DNA identification of scales suspected to be from protected pangolin species.
Keywords: Pangolin, Pangolin scales, Manis sp. Manis pentadactyla pentadactyla, Mitochondrial DNA, D-loop, Forensic DNA
1. Introduction
There are eight extant species of pangolin, four of which are distributed within Africa (Manis tricuspis, M. gigantea, M. tetradactyla and M. temminckii) and four over Asia (M. pentadactyla, M. culionensis, M. crassicaudata and M. javanica) [1]. All eight species are listed on one of the three appendices of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES). The numbers of all eight species are in decline due in part to their tissues used in food products and their scales featuring in traditional East Asian medicines (TEAM). The Formosan pangolin (M. pentadactyla pentadactyla) is the only endemic subspecies in Taiwan and, as their numbers are declining, there is an increase in the illegal importation into Taiwan of pangolin scales for TEAM preparations. The limited morphological features on pangolin scales make it difficult to positively identify a protected species visually, raising the need for a DNA test. The DNA within keratinized pangolin scales is most likely to be degraded and in trace amounts. DNA extraction of the keratinized hair and the successful analysis of trace levels DNA has been reported previously, such as from animal hairs [2], [3], [4], [5], [6], rhino horns [7], ivory samples [8], turtle shells [9], ancient or degraded bones [10], [11], [12], handled objects [13] and burnt stubs [14].
Previous studies involving pangolin have focused on ecology [15], behaviour [16], physiology [17], [18] and comparative anatomy [19]. Some limited studies using pangolin DNA focused on the evolution and phylogeny of mammals in general [20], [21], [22], [23], [24], [25] and comparative genome studies [26]. Currently there are little data on the genetic diversity of pangolin. In 1991, Zhang and Shi reported the genetic diversity of M. pentadactyla based on the partial sequence of the cytochrome b (cyt b) gene by restriction enzyme analysis [27], and in 2007, Luo et al. developed dinucleotide microsatellite markers within the nuclear genome of the Malayan pangolin (M. javanica) [28]. These methods do not result in the unambiguous identification of the protect species, particularly when applied to keratinized samples such as panglin scale where nuclear DNA testing may not possible. Currently registered on GenBank is one complete pangolin mitochondrial genome from M. tetradactyla (accession number NC_004027) and full length or partial gene sequences including: the partial cyt b of M. p. pentadactyla (EU057624–EU057637 and AJ304500), 12S of Manis sp. (AY012154, AF107220 and U61079) and 16S of Manis sp. (AY011188, AF107226 and U97340).
The mtDNA D-loop region of other mammalian species has been used in phylogenetic and population studies [29], [30], [31] and in forensic science studies [32], [33], [34]. The D-loop sequence offers a chance of identification of unknown samples as originating from a pangolin, although there is currently only the one sequence on the GenBank (NC_004027). We report on strategy to obtain full D-loop sequence data from highly degraded DNA obtained from seized scales and a comparison of the resulting data from 19 known Formosan pangolins.
2. Materials and methods
2.1. Sample collections and DNA extraction
A total number of 145 scales, suspected to come from pangolins, were provided by the Council of Agriculture (COA) and the National Museum of Natural Science, Taiwan. Nineteen blood samples of M. p. pentadactyla were provided by Taipei Zoo as reference samples. A sample taken from a pangolin corpse, found on a Taiwan mountain, was selected as a blind trial sample.
DNA extraction from pangolin scales was performed using the Extractor FM Kit (Wako Pure Chemical, Osaka, Japan); this kit has been used on forensic samples such as hair shafts and bone [5], [6]. After pulverizing the pangolin scale with a sterilized blender, approximately 30
mg of pangolin scale powder was suspended in extraction buffer (190
μL lysis solution, 10
μL enzyme-activated reagent solution and 10
μL 100
μg/μL Proteinase K) and incubated at 56
°C overnight. A negative control using 30
μL of ddH2O in place of the pangolin scale was co-extracted with the pangolin scale samples. After DNA precipitation and a washing procedure, the dried DNA pellet was dissolved in 30
μL of ddH2O. DNA extraction of blood samples from the reference material and the muscle tissue of the pangolin corpse were extracted by using the Blood and Tissue Genomic Mini Kit (Viogene, Taiwan).
2.2. Primer design
The eight primer sequences and the primer pairs designed to produce six amplicons are shown in Table 1, Table 2. The priming sites and predicted amplicon size are shown in Fig. 1. Primers L15997uni and H600uni were designed to amplify the full length of the D-loop and were designed according to the sequences upstream and downstream of the D-loop region of M. tetradactyla (Accession no. NC_004027). The other six primers were designed according to the consensus sequences of 19 reference samples (M. p. pentadactyla) generated in this study and the D-loop region of M. tetradactyla (Accession no. NC_004027).
Table 1. The primer sequences used in this study.
| Primer name | Primer sequence (5′–3′) |
|---|---|
| L15997uni | AGCCCCCAAAGCTGATATTCT |
| panDL15825 | CGTGTCCCTCTTCTCGCTCC |
| panDL15943 | CTTAAATAAGACATCTCGATGG |
| panDL16281 | GTACTAAACATCTTGTCAAACC |
| panDH15827 | CCCACAGTCTATATGGGCC |
| panDH15972 | AGGGCATGACACCACAGTTATG |
| panDH16260 | GGTTTGACAAGATGTTTAGTAC |
| H600uni | CATTTTCAGTGCTTTGCTTT |
Table 2. The primer pairs and the PCR conditions used in this study to amplify the D-loop region.
| Fragment | Primer pair | Size (bp) | Annealing temp | Extension time (s) | Cycle number |
|---|---|---|---|---|---|
| A | L15997uni/H600uni | 1240 | 58.3 | 60 | 40 |
| B1 | L15997uni/panDH15972 | 625 | 61.2 | 45 | 35 |
| B2 | panDL15943/H600uni | 689 | 52.2 | 45 | 35 |
| C1 | L15997uni/panDH15827 | 477 | 61.2 | 30 | 30 |
| C2 | panDL15825/panDH16260 | 478 | 61.2 | 30 | 30 |
| C3 | panDL16281/H600uni | 351 | 58.3 | 30 | 30 |

Fig. 1.
The respective position of primer sets and amplicon size at the D-loop region used in this study. Numbering is according to the Manis tetradactyla (NC_004027) in GenBank.
2.3. PCR amplification of D-loop region and DNA sequencing
PCR amplifications were performed in 50
μL of reaction mixture, which contained 5
μL of genomic DNA, reaction buffer (1.5
mM MgCl2, 10
mM Tris–HCl, pH 9.0, 50
mM KCl, 0.1% (w/v) gelatine and 0.1% TritonX-100), 0.15
μM each of primers, 100
μM dNTP and 1.25
units of VioTaq DNA polymerase (Viogene, Taiwan). The amplification was conducted in a GeneAmp PCR System 9700 (Applied Biosystems, Foster, CA, USA) and with the following conditions: 30–40 cycles of 94
°C for 60
s, 52.2–61.2
°C for 45
s and 72
°C for 30–60
s. The detailed amplification condition for each primer set is shown in Table 2. PCR products were checked on a 2% agarose gel, purified with the PCR-M™ Clean Up System (Viogene), and were sequenced using the forward and reverse primers in conjunction with the BigDye™ Terminator Kit (ABI PRISM™ BigDye™ Terminator Cycle Sequencing Ready Reaction Kit, Applied Biosystems). The cycle sequencing products were purified by ethanol precipitation, separated using a POP-7™ polymer (Applied Biosystems) and detected using an ABI 3730 DNA Analyzer.
2.4. Sequence analysis and establishment of a DNA database
The D-loop sequences of all the collected samples were aligned and the pangolin DNA database was established using the BioEdit software [35].
3. Results and discussion
3.1. Establishment of the D-loop sequence for the Formosan pangolin mtDNA
An amplicon of approximately 1240
bp was generated when using the outer primers (L15997uni and H600uni) to amplify the full length of the D-loop from the nineteen reference samples. The complete sequence data for both strands of these amplicons were obtained successfully. After comparison with the mtDNA sequence of M. tetradactyla and excluding the upstream and downstream sequences of the D-loop region, the 1159
bp representing the full length D-loop region for Formosan pangolin was obtained for the 19 samples. Within these 19 sequences there were 6 variable sites representing five haplotypes (Table 3). These haplotypes were subjected to a similarity search within GenBank using the Fasta program, resulting in the highest similarity to the only pangolin species, M. tetradactyla, with a similarity ranging from 73.5% to 73.7%. There were 212 variable nucleotide sites and 35 insertions/deletions (indels) when these haplotypes were aligned with the D-loop sequence of M. tetradactyla. The five haplotypes of the D-loop sequences of M. p. pentadactyla in this study have been registered with GenBank with the following accession numbers GQ232077–GQ232081.
Table 3. Variable nucleotide sites and haplotypes of the D-loop region from nineteen Formosan pangolins and one unknown sample.
3.2. The strategy for complete amplification of D-loop region from pangolin scales
No amplification product was produced for any of the 145 samples suspected of being pangolin scales when using primer pair L15997uni and H600uni to amplify the full length of the D-loop. This was most likely due to the degradation of DNA within the keratinized pangolin scales and the DNA being at a low copy number. A strategy was developed using priming sites to generate amplicons the overlapped and produced a complete D-loop sequence from the degraded DNA. Another six primers were designed to amplify sections of the D-loop (Table 1), based on the consensus sequence of the five haplotypes (accession no. GQ232077–GQ232081) of M. p. pentadactyla and the D-loop region of M. tetradactyla (accession no. NC_004027). The primer sets and respective binding sites are shown in Table 2 and Fig. 1. If the largest amplicon failed (amplicon A with a size of 1240
bp) then B1 (625
bp) and B2 (689
bp) would then be amplified. If they were unsuccessful, the amplicons of C1 (477
bp), C2 (478
bp) and C3 (351
bp) would be amplified. Using this strategy a complete overlapping sequence was obtained for 72 of the 145 samples examined.
3.3. Sequence analysis of the questioned scales
Of the 72 D-loop sequences obtained, there were 47 variable sites resulting in 38 haplotypes (Table 4). These haplotypes were subjected to a similarity search from GenBank using the Fasta program. The species with the highest similarity was M. tetradactyla with a homology score ranging from 71.7% to 82.7%. There were 221 variable nucleotide sites and 37 indels when these haplotypes were aligned with the D-loop sequence of M. tetradactyla. In comparison when aligned with the D-loop sequences of M. p. pentadactyla (GQ232077–GQ232081, this study) these 38 haplotypes had a much higher homology of about 90% with only 130 nucleotide variable sites and 9 indels, indicating that the scales that were suspected to be from a pangolin more likely came from M. p. pentadactyla than M. tetradactyla. These 38 haplotypes of Manis sp. have been registered in GenBank and their accession numbers are shown in Table 4. Although their exact species were still unknown, identification to species level will be possible with the sequencing of voucher specimens obtained from pangolin species.
Table 4. Variable nucleotide sites of 38 haplotypes at the D-loop region from samples suspected to be pangolin scales.
3.4. DNA database construction and blind trial sample analysis
Five haplotypes of M. p. pentadactyla and 38 haplotypes of the samples now identified as being of pangolin in origin were used to compile as a D-loop DNA database using the software BioEdit. The full length D-loop sequence from the tissue sample of the pangolin corpse removed from a mountain in Taiwan was successfully amplified and sequenced using primers L15997uni and H600uni. The D-loop sequence of this blind trial sample was compared with the sequences of GenBank and shown to have a highest similarity for the sequence of M. tetradactyla (73.6%). A similarity of 99.9% was then obtained when comparing to the DNA database generated by our study, accession number GQ232077 of M. p. pentadactyla. These data provided further confidence of the identification of the species of the scale samples and illustrates that with more sequences a DNA database can identify a sample to species level that would not otherwise be possible.
4. Conclusions
In this study, we have outlined a strategy using overlapping amplicons within the D-loop region for the identification of pangolin species from scales samples. Five D-loop haplotypes of M. p. pentadactyla and 38 haplotypes of previously unidentified scales were registered in GenBank and a DNA database was established. It is necessary to collect other pangolin species as reference samples to supplement the sequences in GenBank to aid in both forensic science investigations and the conservation these endangered species.
Acknowledgements
This study was supported by the grant No. 97 preservation fund-2.1-18(4), 98 preservation fund-2.1-28(4) and 99 preservation fund-2.1-39(3) from the Council of Agriculture (COA), National Museum of Natural Science, Taipei Zoo and Department of Medical Research in NTUH, Taiwan, ROC.
References
- . Mammal Species of the World: A Taxonomic and Geographic Reference. 3rd ed.. Baltimore, USA: Johns Hopkins University Press; 2005;
- . STR typing of ancient DNA extracted from hair shafts of Siberian mummies. Forensic Sci. Int. 2007;166:218–229
- . STR typing of human telogen hairs—a new approach. Int. J. Legal Med. 2001;114:269–273
- . DNA profiling of shahtoosh. Electrophoresis. 2006;27:3359–3362
- . Identification of DNA of human origin based on amplification of human-specific mitochondrial cytochrome b region. Forensic Sci. Int. 2005;152:109–114
- . Two universal primer sets for species identification among vertebrates. Int. J. Legal Med. 2007;121:423–427
- . Species identification of rhinoceros horns using the cytochrome b gene. Forensic Sci. Int. 2003;136:1–11
- . Ivory identification by DNA profiling of cytochrome b gene. Int. J. Legal Med. 2009;123:117–121
- . Species identification of Kachuga tecta using the cytochrome b gene. J. Forensic Sci. 2006;51:52–56
- . Comparison and optimization of ancient DNA extraction. Biotechniques. 2007;42:343–352
- . Old cadaver identification from severely spoiled bones: analytical approach to degraded DNA. Forensic Sci. Int.: Genet. Suppl. Ser. 2008;1:444–445
- . A simple and efficient method for PCR amplifiable DNA extraction from ancient bones. Nucleic Acids Res. 2000;28:E67
- . The tendency of individuals to transfer DNA to handled items. Forensic Sci. Int. 2007;168:162–168
- . A novel approach for genotyping of LCN-DNA recovered from highly degraded samples. Int. Congr. Ser. 2006;1288:577–579
- . A preliminary study on burrow ecology of Manis pentadactyla. Ying Yong Sheng Tai Xue Bao. 2004;15:401–407
- . History and dietary husbandry of pangolins in captivity. Zoo. Biol. 2007;26:223–230
- . Oxygen binding functions of blood and hemoglobin from the Chinese pangolin, Manis pentadactyla: possible implications of burrowing and low body temperature. Respir. Physiol. 1986;64:103–112
- . Immunohistochemical study on the distribution and relative frequency of endocrine cells in the stomach of the Malayan Pangolin, Manis javanica. Anat. Histol. Embryol. 2005;34:373–378
- . Comparative anatomical studies on the cerebellar nuclei of the pangolins. J. Hirnforsch. 1983;24:575–589
- . Retroposed elements as archives for the evolutionary history of placental mammals. PLoS Biol. 2006;4:E91
- . Molecular phylogenetics and the origins of placental mammals. Nature. 2001;409:614–618
- . Endemic African mammals shake the phylogenetic tree. Nature. 1997;388:61–64
- . Secondary structure and patterns of evolution among mammalian mitochondrial 12S rRNA molecules. J. Mol. Evol. 1996;43:357–373
- . Morphology and placental mammal phylogeny. Syst. Biol. 2008;57:499–503
- . Evaluating placental inter-ordinal phylogenies with novel sequences including RAG1, gamma-fibrinogen ND6, and mt-tRNA, plus MCMC-driven nucleotide, amino acid, and codon models,. Mol. Phylogenet. Evol. 2003;28:197–224
- . Construction, characterization and FISH mapping of a bacterial artificial chromosome library of Chinese pangolin (Manis pentadactyla). Cytogenet. Genome Res. 2008;122:55–60
- . Genetic diversity in the Chinese pangolin (Manis pentadactyla): inferred from restriction enzyme analysis of mitochondrial DNAs. Biochem. Genet. 1991;29:501–508
- . Isolation and characterization of microsatellite markers in pangolins (Mammalia, Pholidota, Manis spp.). Mol. Ecol. Notes. 2007;7:269–272
- . Molecular characteristics of Tibetan antelope (Pantholops hodgsonii) mitochondrial DNA control region and phylogenetic inferences with related species. Small Rumin. Res. 2008;75:236–242
- . The complete nucleotide sequence of mitochondrial genome in the Japanese Sika deer (Cervus nippon), and a phylogenetic analysis between Cervidae and Bovidae. Small Rumin. Res. 2007;69:46–54
- . Genetic and phylogenetic studies of Chinese native sheep breeds (Ovis aries) based on mtDNA D-loop sequences. Small Rumin. Res. 2007;72:232–236
- . Mitochondrial DNA analysis of domestic dogs in the UK. Forensic Sci. Int.: Genet. Suppl. Ser. 2008;1:598–599
- . Haplotypes of mtDNA control region in Yao ethnic from China. Forensic Sci. Int.: Genet. Suppl. Ser. 2008;1:298–300
- . Sequence polymorphism of mitochondrial D-loop DNA in the Taiwanese Han population. Forensic Sci. Int. 2001;119:239–247
- . BioEdit: a user-friendly biological sequence alignment editor and analysis. program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 1999;41:95–98
PII: S1872-4973(10)00107-9
doi:10.1016/j.fsigen.2010.06.003
© 2010 Elsevier Ireland Ltd. All rights reserved.
Volume 5, Issue 4 , Pages 303-307, August 2011


