Advertisement
Short communication| Volume 7, ISSUE 1, P189-193, January 2013

DNA identification of Salvia divinorum samples

      Abstract

      Salvia divinorum (diviner's sage) is a plant in the mint family that produces an hallucinogenic compound, salvinorin A. The plant is used, often by chewing or smoking, as a “recreational” drug source and is regulated or banned in several states and countries. We describe a simple DNA technique, polymerase chain reaction of the ribulose bisphosphate carboxylase large subunit (rbcL) gene, that can distinguish S. divinorum leaf pieces from pieces of tobacco or cannabis. We have also found DNA sequences adjacent to the chloroplast leucine transfer RNA (trnL) gene that are specific to S. divinorum and distinguish it from other horticulturally popular Salvia species. We report some significant differences between the S. divinorum trnL sequences we determined and those now published in GenBank.

      Keywords

      The mint family is a family of plants known for the variety of their secondary metabolic products. Among species in this family, Salvia divinorum Epling & Játiva (Lamiaceae) is unusual for its synthesis of a hallucinogenic compound, salvinorin A [
      • Valdés III, L.J.
      • Hatfield G.M.
      • Koreeda M.
      • Paul Ag.
      Studies of Salvia divinorum (Lamiaceae), an Hallucinogenic Mint from the Sierra Mazateca in Oaxaca, Central Mexico.
      ,

      T.A. Munro, The chemistry of Salvia divinorum, Ph.D. thesis, University of Melbourne, Melbourne, Australia, 2006.

      ]. Salvinorin A is a trans-neoclarodane diterpenoid [

      T.A. Munro, The chemistry of Salvia divinorum, Ph.D. thesis, University of Melbourne, Melbourne, Australia, 2006.

      ]. It acts through the kappa-opioid receptor [
      • Roth B.L.
      • Baner K.
      • Westkaemper R.
      • Siebert D.
      • Rice K.C.
      • Steinberg S.
      • et al.
      Salvinorin A: a potent naturally occurring nonnitrogenous κ opioid selective agonist.
      ,
      • Chavkin C.
      • Sud S.
      • Jin W.
      • Stewart J.
      • Zjawiony J.K.
      • Siebert D.J.
      • et al.
      Salvinorin A, an active component of the hallucinogenic sage Salvia divinorum is a highly efficacious kappa-opioid receptor agonist: structural and functional considerations.
      ] and is similar in efficacy to the receptor's natural peptide ligand, dynorphin A [
      • Chavkin C.
      • Sud S.
      • Jin W.
      • Stewart J.
      • Zjawiony J.K.
      • Siebert D.J.
      • et al.
      Salvinorin A, an active component of the hallucinogenic sage Salvia divinorum is a highly efficacious kappa-opioid receptor agonist: structural and functional considerations.
      ].
      S. divinorum has been used in religious rites by Mazatec shamans to induce hallucinatory visions [
      • Reisfield A.S.
      The botany of Salvia divinorum (Labiatae).
      ]. More recently, it has become an experimental drug for teenagers and others seeking new experiences. In a 2008 survey, 2.8% of 55,739 respondents answered “yes” to having “ever, even once, used Salvia divinorum” [
      National Survey on Drug Use and Health.
      ]. Many Internet sites describe the effects of smoking or chewing S. divinorum leaves as powerful but short-lived. A placebo-controlled study [
      • Johnson M.W.
      • MacLean K.A.
      • Reissig C.J.
      • Prisinzano T.E.
      • Griffiths R.R.
      Human psychopharmacology and dose-effects of salvinorin A, a kappa opioid agonist hallucinogen present in the plant Salvia divinorum.
      ] found that the effects of inhaling doses of salvinorin A ranging from 0.375 to 21 μg/kg lasted for about 20 min.
      S. divinorum, S. divinorum extract, and salvinorin A are not listed in the federal Controlled Substances Act. However, some degree of regulation has been passed by legislatures of 20 US states [http://en.wikipedia.org/wiki/Legal_status_of_Salvia_divinorum]. Canada and California prohibit sales to minors [
      • Johnson M.W.
      • MacLean K.A.
      • Reissig C.J.
      • Prisinzano T.E.
      • Griffiths R.R.
      Human psychopharmacology and dose-effects of salvinorin A, a kappa opioid agonist hallucinogen present in the plant Salvia divinorum.
      ]. A number of countries, including Australia, Sweden, Germany, Italy, and Spain have controlled import, sale or use of S. divinorum or salvinorin A.
      The mint family is very large, including over 7000 recognized species [
      • Harley R.M.
      • Atkins S.
      • Budantsev A.L.
      • Cantino P.D.
      • Conn B.J.
      • Grayer R.J.
      • et al.
      “Labiatae”.
      ]. The genus Salvia (sage) has over 900 species [
      • Walker J.B.
      • Sytsma K.J.
      • Treutlein J.
      • Wink M.
      Salvia (Lamiaceae) is not monophyletic: implications for the systematics, radiation, and ecological specializations of Salvia and tribe Mentheae.
      ]. S. divinorum is a small to medium-sized shrub with two simple ovate leaves arising from each node in opposite conformation (Fig. 1). Branching at the nodes is frequent. Flowering is rare. However, the plant can easily by propagated by placing a small shoot with an apical or axillary bud in moist soil. S. divinorum is an unremarkable plant, easily recognizable as a member of the mint family by its square stem, but without flowers it is more difficult to distinguish from many other members of its genus or of the large mint family. S. divinorum leaves are generally large compared to those of other Salvia species used in gardening and cooking (Fig. S1). However, the detached leaves are not easy to identify by shape or size, and it is even more difficult to identify S. divinorum leaves that have been dried and shredded for smoking (Fig. S2). One direct and relevant method is to extract and identify the active principle, salvinorin A [

      T.A. Munro, The chemistry of Salvia divinorum, Ph.D. thesis, University of Melbourne, Melbourne, Australia, 2006.

      ]. A second method involves the determination of specific DNA sequences to identify tissues of the plant. A recent study used DNA sequences to place S. divinorum in the mint family tree [
      • Jenks A.A.
      • Walker J.B.
      • Kim S.-C.
      Evolution and origins of the Mazatec hallucinogenic sage, Salvia divinorum (Lamiaceae): a molecular phylogenetic approach.
      ]. This study indicated that S. divinorum is a true species, not a hybrid, and that its closest relative is Salvia venulosa, a rare endemic found in Colombia.
      Figure thumbnail gr1
      Fig. 1Laboratory-grown Salvia divinorum plant. Upper right: inflorescence (from Reisfield, www.sagewisdom.org/reisfield.html).
      The objective of this project was to define DNA procedures that could distinguish S. divinorum tissue from that of two other drug plants likely to be prepared for smoking, Cannabis sativa and Nicotiana tabacum, and from other Salvia species.

      1. Materials and methods

      1.1 Plant samples

      Dried, identified samples of S. divinorum were obtained from the University and Jepson Herbarium, University of California, Berkeley (accessions UC1591867, dry leaf; LA47663, dry flower). Leaf samples of live plants were obtained from the University of California, Berkeley Botanical Garden (accessions 92.0391 and 89.1680) and from the Botanical Conservatory of the University of California, Davis. A live S. divinorum plant was purchased commercially and propagated by cuttings. Dried S. divinorum leaves, sold for smoking, were also purchased commercially.
      Samples of other Salvia species were obtained from the University Arboretum, Davis. Fresh leaves of N. tabacum were obtained from a UC Davis laboratory. Samples of C. sativa were obtained from the Bakersfield, CA police department.

      1.2 Isolation of DNA

      DNA was isolated from fresh and dried leaves, following a modification of the CTAB procedure of Murray and Thompson [
      • Murray M.G.
      • Thompson W.F.
      Rapid isolation of high-molecular-weight plant DNA.
      ]. Samples of live leaves, ca. 0.15 g, were cut into small pieces, frozen in liquid N2 in a 1.5-mL plastic tube, ground with an acid-treated plastic pestle, and re-ground to homogeneity in the presence of 300 μL of buffer containing 2% cetyltrimethyl ammonium bromide, 1.4 M NaCl, 20 mM ethylenedinitrilotetraacetic acid, and 100 mM Tris buffer, pH 8, plus 2 μL of mercaptoethanol. Dried leaves, ca. 0.05 g, were treated similarly, but not frozen. The mixture was heated at 65 °C for 10 min or more and then cooled and extracted with chloroform. DNA in the aqueous layer was precipitated with isopropanol. After centrifugation, the pellet was washed with 70% ethanol, dried and dissolved in water. The DNA was further purified by adsorption on glass filters, washing the filters with an ethanol–salt solution (Promega Corporation, Madison, WI, USA), and elution of the DNA with 50 μL of water.

      1.3 PCR

      PCRs were conducted in 20 μL of solution containing 12.1 μL of water, 4 μL of 5× Green Go Taq Buffer (Promega), 1.6 μL dNTPs (2.5 mM of each dNTP), 0.125 μL Taq DNA Polymerase (Go Taq, 5 u/μL, Promega), 0.6 μL of each primer (forward and reverse, 20 mM), and 1 μL of template DNA. Normal PCR conditions were 96 °C for 1 min; 35 cycles of 94 °C for 30 s, 52–59 °C (depending on primer) for 30 s, and 72 °C for 1 min; 72 °C for 5 min; 4 °C hold.

      1.4 Primer selection

      Primers were designed to amplify segments of DNA from the plastid ribulosebisphosphate carboxylase large subunit (rbcL) gene and the region around the plastid leucine transfer RNA (trnL) gene (Table 1). These sequences are particularly useful in identifying plant materials since the plastid genes that they amplify are missing in genomes of animals and fungi that might contaminate plant samples. The rbcL gene has also been recommended for plant barcoding [
      CBOL Plant Working Group
      A DNA barcode for land plants.
      ]. We chose the trnL gene based on the recent sequence work on the genus Salvia [
      • Jenks A.A.
      • Walker J.B.
      • Kim S.-C.
      Evolution and origins of the Mazatec hallucinogenic sage, Salvia divinorum (Lamiaceae): a molecular phylogenetic approach.
      ]. Other genes have been recommended for identification of plant species over a wide taxonomic range [
      CBOL Plant Working Group
      A DNA barcode for land plants.
      ,
      China Plant BOL Group
      Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants.
      ].
      Table 1Primers used in amplification of rbcL and trnL sequences.
      Primer sequence
      rbcLF1AGTTCCCCCTGAAGAAGCAG
      rbcLR1TTCATTACCCTCACGAGCAAG
      trnLF1AGCTGTTCTAACAAATGGAGTTG
      trnLR1GGACTCTATCTTTGTTCTCGTCC
      trnLF3GAAATTTATAGTAAGAGGAAAATCCGTCG
      trnLR2TTCCTTGCTTCATTTGCAATGTG

      1.5 Analysis of PCR products

      The products of PCR reactions (8 μL) were treated with 1 μL of the indicated restriction enzymes (Promega) plus 1 μL of supplied buffer for 3 h at 37 °C. Restriction products were separated by electrophoresis on 12% acrylamide gels, stained with ethidium bromide, and visualized with ultraviolet light.
      DNA sequencing of PCR-amplified DNA was performed by the local College of Biological Science UCDNA Sequencing Facility. Sequences of rbcL and trnL genes were also obtained from GenBank.

      2. Results

      2.1 rbcL: use to distinguish smoking materials

      Using PCR to amplify the rbcL gene, it was possible to distinguish S. divinorum DNA from that of two other materials commonly used for smoking, C. sativa and N. tabacum. The amplified DNAs had characteristic sequences (Fig. S3), and products could be easily distinguished by cleaving them with restriction enzymes (Fig. 2a and b ). By sequencing amplified rbcL DNA, it was also possible to distinguish S. divinorum from Salvia greggii, Salvia × jamensis, Salvia chionophylla, Salvia microphylla, Salvia dolomitica, Salvia clevelandii, and Salvia cedrosensis (Table 2).
      Figure thumbnail gr2
      Fig. 2The patterns of DNA fragments from restriction digests of rbcL amplicons produced using template DNA from S. divinorum, C. sativa, or N. tabacum.
      Table 2Sequence differences found between rbcL genes of Salvia species.
      divgrejamchimiccedcledol
      div55535919
      gre500241318
      jam500241318
      chi500241318
      mic322221118
      ced544421320
      cle9131313111319
      dol19181818182019
      Sequences were amplified using primers rbcLF1 and rbcLF2. div, S. divinorum; gre, S. greggii; jam, S. × jamensis; chi, S. chionophylla; mic, S. microphylla; dol, S. dolomitica; ced, S. cedrosensis; cle, S. clevelandii.

      2.2 trnL: use to distinguish Salvias

      Although it is possible to distinguish S. divinorum from many other Salvias using the rbcL gene sequence, we expected that better differentiation would result from a comparison of the chloroplast sequences including and adjacent to the trnL gene. We chose primers of that region that would amplify DNA of small size (∼300 bp), given our experience that DNA in dried and degraded plant material may be fragmented. Of the sequences that would be amplified by primers trnLF1 and trnLR1 from a sample of 156 trnL template sequences in GenBank (2 S. divinorum accessions plus 154 other Salvia species), 132 could be distinguished from S. divinorum. Another 22 matched the S. divinorum sequences exactly. By using primer sequences trnLF3 and trnLR2 to identify a different segment of the trnL gene, all the species, except S. venulosa, would be distinguished from S. divinorum. S. divinorum and S. venulosa were indicated as having two inserts of 27 and 32 bases that were not found in any of the other species tested (Fig. 3).
      Figure thumbnail gr3
      Fig. 3Graphical description of a section of chloroplast DNA of Salvia species containing the trnL intron, part of the trnL gene and the trnL-trnF intergenic spacer, and showing the relative locations of primers used in this work and of two insertions for S. divinorum noted in previous GenBank accessions (see text). The total length of the DNA diagrammed here is 598 bp. The solid arrow shows the putative position of the 3′ segment of the trnL gene. The 5′ segment of the trnL gene starts approximately 200 bp to the left of this section; the trnF gene starts approximately 130 bp to the right.
      We compared the GenBank data to sequences that we amplified using primer pairs trnLF1/trnLR1 and trnLF3/trnLR2 with DNA templates from four separate accessions of S. divinorum, two from the UC Berkeley Herbarium and two from the UC Berkeley Arboretum (Fig. S4a and b). Using trnLF1/trnLR1, our sequences matched GenBank sequences DQ667440.1 and HQ418964.1 exactly, but using trnLF3/trnLR2, our four sequences did not match DQ667440.1 and HQ418964.1—our sequences differed by the two inserts mentioned above, present in the GenBank sequences but not in the ones we determined (Fig. 3 and Fig. S4b).
      Using the trnLF1 and trnLR1 primers, we could distinguish the sequence of S. divinorum from 11 of the 12 species that we tested, all but S. cedrosensis (Table 3, Fig. S5). Using the trnLF3 and trnLR2 primers, there were differences between S. divinorum and all 12 of the other species, including S. cedrosensis (Table 4, Fig. S6).
      Table 3Sequence differences found between trnL genes of Salvia species.
      divcedmicgrejamchiapicleofflevrecdolsyl
      div012229111212131717
      ced0122210111212131717
      mic1133311121313141818
      gre2230310111010111515
      jam2230310111010111515
      chi223331113813141817
      api9101110101111111121214
      cle11111211111311010111113
      off1212131010810110156
      lev12121310101310110156
      rec13131411111411121167
      dol17171815151811125567
      syl17171815151713146677
      Sequences were amplified with primers trnLF1 and trnLR1. div, S. divinorum; ced, S. cedrosensis; mic, S. microphylla; gre, S. greggii; jam, S. × jamensis; chi, S. chionophylla; off, S. officinalis; lev, S. lavandulifolia; rec, S. recognita; dol, S. dolomitica; syl, S. × sylvestris; cle, S. clevelandii; api, S. apiana.
      Table 4Sequence differences found between trnL genes of Salvia species.
      divmicjamchicleapicedgredolrecsyllevoff
      div44455781011121212
      mic4007734811101212
      jam4007734811101212
      chi4007734811101212
      cle5777010111112131313
      api5777010111112131313
      ced7333101061012131413
      gre8444111161211101212
      dol10888111110125266
      rec11111111121212115311
      syl12101010131313102344
      lev12121212131314126140
      off12121212131313126140
      Sequences were amplified with primers trnLF3 and trnLR2. Abbreviations: see Table 3.

      3. Discussion

      PCR identification of S. divinorum DNA in samples provides a rapid and convenient method of identifying plants, leaves, and shredded samples of the plant. The DNA sequences of the rbcL genes include restriction sites that allow a distinction between samples of S. divinorum, C. sativa, and N. tabacum (Fig. 2) and mixtures of these (data not shown). A January, 2012 BLAST search on GenBank, using the rbcL amplicon shown in Fig. S3, retrieved the sequence from S. divinorum with no ambiguities or differences. However, the next 24 entries, species of Salvia—with one exception, another genus of the mint family—showed very high similarities.
      A comparison of the trnL ampicons also excludes plants of other families and gives better distinction between Salvia species. A BLAST search using the amplicon shown in Fig. S5 retrieved sequences, the first 100 of which were solely from Salvia species. Using the amplicon shown in Fig. S6, the first 100 sequences retrieved were all from mint family plants; 94 were from species of Salvia. Although the numbers of differences between S. divinorum and certain other Salvias are low (Table 3, Table 4), these numbers relate to a shorter amplified sequence and include some very characteristic multi-base insertion/deletions (Figs. S5 and S6). The sequences that would be amplified by the trnLF1/trnLR1 and trnLF3/trnLR2 primers, accessed from 148 GenBank records (but neglecting the inserts that we could not confirm), were able to distinguish every species from S. divinorum, except for S. venulosa. S. venulosa has already been reported to be a close relative of S. divinorum [
      • Jenks A.A.
      • Walker J.B.
      • Kim S.-C.
      Evolution and origins of the Mazatec hallucinogenic sage, Salvia divinorum (Lamiaceae): a molecular phylogenetic approach.
      ] on the basis of gene sequences. S. venulosa is a very rare plant that, at least so far, is unlikely to turn up in forensic investigations.
      We have no explanation for the differences between trnL sequences of S. divinorum that we amplified with trnLF3/trnLR2 primers and those reported in GenBank earlier (Fig. 3; Fig. S4). We also found differences in some trnL sequences amplified using trnLF1/trnLR1 primers: the sequences from S. divinorum and five other species matched the GenBank data, but our sequences of S. greggii and S. sylvestris differed from the web sequences by lacking inserts of 10 and 6 bases, respectively.
      It seems that an investigator using the trnL sequence to test an unknown sample might incorrectly reject it as S. divinorum if it lacked the insertions noted in Fig. 3. At present, we suggest that an investigator who uses trnL sequences to identify a Salvia sample consider both web sequences and those presented here.

      Acknowledgments

      The authors thank Andrew Doran of the University of California (UC) Berkeley Herbarium, Holly Forbes of the UC Berkeley Conservatory and Arboretum, Ernesto Sandoval of the UC Davis Conservatory, and the UC Davis Arboretum for providing Salvia samples. Henry Mu and Katherine Wright provided technical help.

      Appendix A. Supplementary data

      The following are the supplementary data to this article:
      Figure thumbnail mmc1
      Fig. S1Comparison of eight common horticultural Salvia species to laboratory-grown S. divinorum. The same scale is shown in all pictures (length 33 cm).
      Figure thumbnail mmc2
      Fig. S2A sample of dried S. divinorum leaves commercially offered for smoking.
      • Fig. S4

        Partial sequences the trnL gene of S. divinorum samples. Samples are denoted by the last three digits of their ID numbers (see text). The first four were sequenced in this work; the last two are from GenBank. (a) 5′ region. (b) 3′ region. Primer regions in red.

      References

        • Valdés III, L.J.
        • Hatfield G.M.
        • Koreeda M.
        • Paul Ag.
        Studies of Salvia divinorum (Lamiaceae), an Hallucinogenic Mint from the Sierra Mazateca in Oaxaca, Central Mexico.
        Econ. Bot. 1987; 41: 283-291
      1. T.A. Munro, The chemistry of Salvia divinorum, Ph.D. thesis, University of Melbourne, Melbourne, Australia, 2006.

        • Roth B.L.
        • Baner K.
        • Westkaemper R.
        • Siebert D.
        • Rice K.C.
        • Steinberg S.
        • et al.
        Salvinorin A: a potent naturally occurring nonnitrogenous κ opioid selective agonist.
        Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 11934-11939https://doi.org/10.1073/pnas.182234399
        • Chavkin C.
        • Sud S.
        • Jin W.
        • Stewart J.
        • Zjawiony J.K.
        • Siebert D.J.
        • et al.
        Salvinorin A, an active component of the hallucinogenic sage Salvia divinorum is a highly efficacious kappa-opioid receptor agonist: structural and functional considerations.
        J. Pharmacol. Exp. Ther. 2004; 308: 1197-1203
        • Reisfield A.S.
        The botany of Salvia divinorum (Labiatae).
        SIDA Contrib. Bot. 1993; 15 (Updated (as of December 2011): http://www.sagewisdom.org/reisfield.html.): 349-366
      2. National Survey on Drug Use and Health.
        2008https://doi.org/10.3886/ICPSR23782.v2
        • Johnson M.W.
        • MacLean K.A.
        • Reissig C.J.
        • Prisinzano T.E.
        • Griffiths R.R.
        Human psychopharmacology and dose-effects of salvinorin A, a kappa opioid agonist hallucinogen present in the plant Salvia divinorum.
        Drug Alcohol Depend. 2011; 115: 150-155
        • Harley R.M.
        • Atkins S.
        • Budantsev A.L.
        • Cantino P.D.
        • Conn B.J.
        • Grayer R.J.
        • et al.
        “Labiatae”.
        in: The Families and Genera of Vascular Plants. vol. VII. 978-3-540-40593-1 Springer-Verlag, Berlin, Heidelberg, Germany2004: 167-275
        • Walker J.B.
        • Sytsma K.J.
        • Treutlein J.
        • Wink M.
        Salvia (Lamiaceae) is not monophyletic: implications for the systematics, radiation, and ecological specializations of Salvia and tribe Mentheae.
        Am. J. Bot. 2004; 91: 1115-1125
        • Jenks A.A.
        • Walker J.B.
        • Kim S.-C.
        Evolution and origins of the Mazatec hallucinogenic sage, Salvia divinorum (Lamiaceae): a molecular phylogenetic approach.
        J. Plant Res. 2011; 124: 593-600https://doi.org/10.1007/s10265-010-0394-6
        • Murray M.G.
        • Thompson W.F.
        Rapid isolation of high-molecular-weight plant DNA.
        Nucleic Acid Res. 1980; 8: 4321-4325
        • CBOL Plant Working Group
        A DNA barcode for land plants.
        Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 12794-12797
        • China Plant BOL Group
        Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants.
        Proc. Natl. Acad. Sci. U.S.A. 2011; 108: 19641-19646