Abstract
In forensic science, the identification of feces is very important in a variety of crime investigations. However, no sensitive and simple fecal identification method using molecular biological techniques has been reported. Here, we focused on the fecal bacteria, Bacteroides uniformis, Bacteroides vulgatus and Bacteroides thetaiotaomicron, and developed a novel fecal identification method by detection of the gene sequences specific to these bacteria in various body (feces, blood, saliva, semen, urine, vaginal fluids and skin surfaces) and forensic (anal adhesions) specimens. Bacterial gene detection was performed by real-time PCR using a minor groove binding probe to amplify the RNA polymerase β-subunit gene of B. uniformis and B. vulgatus, and the α-1-6 mannanase gene of B. thetaiotaomicron. At least one of these bacteria was detected in the feces of 20 donors; the proportions of B. uniformis, B. vulgatus and B. thetaiotaomicron were 95, 85 and 60%, respectively. Bacteroides vulgatus was also detected in one of six vaginal fluid samples, but B. thetaiotaomicron and B. uniformis were not detected in body samples other than feces. Further, we applied this method to forensic specimens from 18 donors. Eighteen anal adhesions also contained at least one of three bacteria; B. uniformis, B. vulgatus and B. thetaiotaomicron were detected in 89, 78 and 56%, respectively, of the specimens. Thus, these bacteria were present at a high frequency in the fecal and forensic specimens, while either B. uniformis or B. vulgatus was detected in all samples. Therefore, B. uniformis and B. vulgatus represent more appropriate target species than B. thetaiotaomicron for the identification of fecal material. If B. vulgatus and/or B. uniformis are detected, it is likely that the sample contains feces. Taken together, our results suggest that the use of molecular biological techniques will aid the detection of feces in forensic practice, although it is possible that the samples contained both feces and vaginal fluid.
Keywords
1. Introduction
The identification of body fluid species is very important in forensic science, as facts relating to the crime can in this way be proved objectively. Moreover, identification is essential for a screening test prior to DNA genotyping. Further, the identification of feces is important evidence in particular crimes, including illegal fly tipping, harassment and sexual assault (particularly in cases of anal sexual assault); a trace of feces derived from the victim on the surface of a condom left at the crime scene can be crucial evidence. Honda and Shinohara [
[1]
] previously reported a method of feces detection by the analysis of steroids using gas chromatography. However, application of this method in forensic practice is difficult since it requires a significant quantity of sample and is complex to perform. Therefore, it is necessary to develop a sensitive and simple identification method for feces.We reported previously a novel method of saliva identification by detecting bacteria in the oral cavity using a molecular biological technique [
2
, 3
]. On the other hand, Fleming and Harbison [[4]
] identified vaginal fluid by the detection of Lactobacillus species. Further, Giampaoli et al. [[5]
] reported the identification of vaginal fluid from various body fluids via the detection microbial signatures using a multiplex real-time PCR assay. Such PCR-based methods are highly sensitive, simple and useful in forensic practice. Similar to the oral cavity and vaginal fluid, a large number of bacterial species are present in feces. The microbial flora of the human intestinal tract comprises over 1011 bacterial cells per gram of colonic content, and it contains more than 400 bacterial species [[6]
]. Moreover, a large proportion of the fecal mass consists of bacteria (∼60% of fecal solids) [[7]
]. Bacteroides species account for as much as 30% of fecal bacteria [[8]
]. As these bacteria are the most dominant in feces, they have been used in water pollution investigations and many studies where fecal matter was the target [9
, 10
, 11
, 12
, 13
, 14
, 15
, 16
]. Many recent reports of the detection of bacteria from feces have been performed using real-time PCR [12
, 13
, 14
, 15
, 16
], which allows simple and rapid detection.Here, we focused on three Bacteroides species, B. uniformis, B. vulgatus and B. thetaiotaomicron, because they are more dominant than other Bacteroides species in feces [
[17]
], and reports of their existence in other body fluids are few [6
, 18
, 19
]. Next, we developed a novel feces detection method based on an endpoint assay automatically judged by real-time PCR using a gene sequence specific to these bacteria. In this study, we investigated the specificity for feces of these bacteria using various body specimens (feces, blood, saliva, semen, urine, vaginal fluids and skin surfaces), and evaluated this method of feces detection using forensic samples (anal adhesions).2. Materials and methods
2.1 Samples
All donors were healthy Japanese adults with no known diseases, including carcinoma of the gastrointestinal tract. Also, they had no history of antibiotic use, which may disturb the gut microbial flora, within 2 weeks before sample collection. Feces, blood, saliva, semen, and urine samples were collected from 20 donors and adhered to cotton swabs. Skin bacteria were collected from 20 donors by wiping the skin with a wet cotton swab; vaginal fluid samples were collected from six donors using a cotton swab. Forensic samples were collected from 18 donors by wiping the anus with a cotton swab. Informed consent was obtained from all participants who provided samples.
The bacterial strains used in this study were B. uniformis ATCC 8492, B. vulgatus ATCC 8482, B. thetaiotaomicron ATCC 29741, B. fragilis ATCC 25285, Bacillus subtilis ATCC 6633, Escherichia coli ATCC 35218, Pseudomonas aeruginosa ATCC 27853, Serratia marcescens ATCC 8100, Staphylococcus aureus ATCC 25923 and Streptococcus salivarius ATCC 13419. These strains were purchased from Microbiologics (St. Cloud, MN, USA). All Bacteroides species were cultured on Bacteroides Agar “Nissui” (Nissui Pharmaceutical Co., Tokyo, Japan). The streptococci were cultured on Mitis-Salivarius Agar (BHI, Difco Laboratories, Detroit, MI, USA), and the remaining bacteria were cultured on Nutrient Agar (BHI).
2.2 DNA extraction
The samples were removed from a 3 × 3-mm piece of cotton swab. DNA extraction and purification were performed using an EZ1 Investigator Kit (Qiagen, Valencia, CA, USA), according to the manufacturer's protocol, and elution was carried out using 50 μL of water. In the cultured bacterial samples, DNA was extracted and purified using a QIAamp® Mini Kit (Qiagen) according to the manufacturer's protocol, and elution was performed using 150 μL of water. The quantity and purity of the DNA was evaluated by means of OD260 and OD260/280 measurements using a spectrophotometer (NanoDrop 1000; Thermo Fisher Scientific Inc., Waltham, MA, USA). The reproducibility of the purification process was confirmed by evaluating several cultured bacterial samples using commercially available kits (EZ1 Investigator Kit, QIAamp® Mini Kit and Prepfiler DNA Extraction Kit; Life Technologies, Carlsbad, CA, USA). Further, feces generally contain polymerase inhibitors that obstruct PCR and increase the Ct-value in real-time PCR. The fecal DNA extract had no effect on the Ct-value of the TaqMan® Exogenous Internal Positive Control (IPC; Life Technologies), indicating that such inhibitors were removed by the DNA extraction and purification process.
2.3 Real-time PCR
Bacteroides uniformis, B. vulgatus and B. thetaiotaomicron were chosen as the target bacteria. Detection of bacterial genes was performed by real-time PCR using a minor groove binding (MGB) probe. Primers were designed using Primer Express® software (Life Technologies) to amplify the RNA polymerase β-subunit (rpoB) gene from B. uniformis and B. vulgatus, and the α-1-6 mannanase gene of B. thetaiotaomicron (GenBank accession numbers AY338188, AY338189 and NC004663, respectively). The selected primer target sites were compared to all available sequences by using the BLAST database search program (www.ncbi.nlm.nih.gov/BLAST), and were checked to be complementary with the target species but not with other species. The primer sequences are shown in Table 1.
Table 1Primer sequences used in this study.
| Target | Primer | Sequence (5′–3′) | Gene |
|---|---|---|---|
| B. uniformis | Forward | GACCTGATTAACGCCAAGACAAT | rpoB |
| Reverse | TGACAAAGCATTCGTTCCAAAG | ||
| Prove | FAM-TCTTCCGTTATCAATTCA-MGB | ||
| B. vulgatus | Forward | CGATTGGTCTGGCACGTATG | rpoB |
| Reverse | ACTTCATTGTCACGCACATTCAT | ||
| Prove | FAM-TCGTACCATCCGTGAGC-MGB | ||
| B. thetaiotaomicron | Forward | TACAATTGCCACAGTACGGAACA | a-1-6 mannanase |
| Reverse | GCTGACGAACGATGACCATAGTTA | ||
| Prove | FAM-ATGAGATTTCTGCCATAGCA-MGB | ||
PCR was performed in 50-μL reaction mixtures containing 2× TaqMan® Universal PCR Master Mix (Life Technologies), 900 nM oligonucleotide primers, 250 nM probes, and 1 μL of template DNA. PCR amplification was performed using the 7500 Real-Time PCR System (Life Technologies) programmed for 2 min at 50 °C and 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C.
A positive reaction was statistically and automatically judged using the “Presence/Absence mode” (endpoint assay) installed in the 7500 Real-Time PCR System and the TaqMan® Exogenous Internal Positive Control Reagents Kit (Life Technologies) according to the manufacturer's protocol. This system enables the identification of samples that are positive and negative for a specific target sequence, and it can discriminate two types of negative reactions: no target sequence and the presence of a PCR inhibitor. The positive threshold values were decided based on a statistical analysis of data from no template DNA and negative IPC controls.
We analyzed the DNA extract from all cultured bacterial samples by triplicate endpoint assays. The detection limits of this method were determined from the positive results of three independent experiments.
3. Results
3.1 Evaluation of the real-time PCR
We succeeded in the detection of cultured B. uniformis, B. vulgatus and B. thetaiotaomicron using real-time PCR. The detection limits of this method using template DNA from B. uniformis, B. vulgatus and B. thetaiotaomicron were 50, 100 and 50 fg, respectively (corresponding to the amount of DNA in approximately 10, 18, and 7 bacteria, respectively). Each primer set specifically amplified the DNA of the target bacteria and produced no false positives from non-target bacteria when DNA obtained from six species of well-known environmental bacteria (B. subtilis, E. coli, P. aeruginosa, S. marcescens, S. aureus and S. salivarius) and four species of Bacteroides (B. uniformis, B. vulgatus, B. thetaiotaomicron and B. fragilis) were amplified by real-time PCR using 1 ng of template DNA.
3.2 Detection of Bacteroides from human feces and other human body samples
Table 2 shows the results of the detection of B. uniformis, B. vulgatus and B. thetaiotaomicron in the feces of 20 donors. The detection rates of B. uniformis, B. vulgatus and B. thetaiotaomicron were 95% (19/20), 85% (17/20) and 60% (12/20), respectively. All three bacteria were detected in samples from 11 of the donors, and at least one of the three bacteria was detected in all 20 fecal samples.
Table 2The results of detection of Bacteroides from feces of 20 donors.
| Donor no. | B. uniformis | B. vulgatus | B. thetaiotaomicron |
|---|---|---|---|
| 1 | + | + | + |
| 2 | + | + | − |
| 3 | + | − | − |
| 4 | + | + | + |
| 5 | + | + | − |
| 6 | + | + | + |
| 7 | + | + | + |
| 8 | + | + | + |
| 9 | + | + | + |
| 10 | + | + | − |
| 11 | − | + | − |
| 12 | + | + | − |
| 13 | + | − | + |
| 14 | + | + | + |
| 15 | + | + | + |
| 16 | + | + | + |
| 17 | + | + | + |
| 18 | + | − | − |
| 19 | + | + | + |
| 20 | + | + | − |
Table 3 shows the results of the detection of B. uniformis, B. vulgatus and B. thetaiotaomicron in blood, saliva, semen, urine, vaginal fluid and skin surfaces. Neither B. uniformis nor B. thetaiotaomicron were detected in blood, saliva, semen, urine, vaginal fluid and skin surfaces. Bacteroides vulgatus was not detected in blood, saliva, semen, urine and skin surfaces, but was detected in one of the six vaginal fluid samples.
Table 3The number of positive reaction of detection of Bacteroides in various body samples.
| Sample | n | B. uniformis | B. vulgatus | B. thetaiotaomicron |
|---|---|---|---|---|
| Blood | 20 | 0 | 0 | 0 |
| Saliva | 20 | 0 | 0 | 0 |
| Semen | 20 | 0 | 0 | 0 |
| Urine | 20 | 0 | 0 | 0 |
| Vaginal fluid | 6 | 0 | 1 | 0 |
| Skin surfaces | 20 | 0 | 0 | 0 |
3.3 Forensic application
Table 4 shows the results of the detection of B. uniformis, B. vulgatus and B. thetaiotaomicron in the anal adhesions of 18 donors. The detection rates of B. uniformis, B. vulgatus and B. thetaiotaomicron were 89% (16/18), 78% (14/18) and 56% (10/18), respectively. The detection rates of these bacteria in the anal adhesion samples were lower than in the feces samples, but all or some of these bacteria were detected in all 18 anal adhesions. Further, using this method, feces were detectable from a fecal stain sample stored for 1 year at room temperature (n = 1).
Table 4The results of detection of Bacteroides from anal adhesions of 18 donors.
| Donor no. | B. uniformis | B. vulgatus | B. thetaiotaomicron |
|---|---|---|---|
| 1 | + | + | + |
| 2 | − | + | − |
| 3 | + | − | − |
| 4 | + | + | + |
| 5 | + | − | − |
| 6 | + | + | + |
| 7 | + | + | + |
| 8 | + | + | + |
| 10 | + | + | − |
| 11 | − | + | − |
| 12 | + | + | − |
| 13 | + | − | + |
| 14 | + | + | + |
| 15 | + | + | + |
| 16 | + | + | + |
| 17 | + | − | + |
| 18 | + | + | − |
| 20 | + | + | − |
4. Discussion
As Bacteroides are the predominant bacteria in feces, we developed a novel fecal identification method detection of the specific sequence of the rpoB gene of B. uniformis and B. vulgatus, and the α-1-6 mannanase gene of B. thetaiotaomicron. Each primer set was designed to amplify sequence targets present only in the bacteria of interest. The detection limit of the real-time PCR was <1 pg of DNA template. Thus, this method is highly sensitive for the detection of B. uniformis, B. vulgatus and B. thetaiotaomicron. Additionally, our method was simpler and sensitive compared to the previously reported fecal identification method that required a complicated pre-treatment process and a large amount of fecal sample to achieve gas chromatography [
[1]
]. In fact, it was possible to detect at least one of these bacteria in the forensic anal adhesion samples (small quantity of feces).Our results show that B. uniformis, B. vulgatus and B. thetaiotaomicron were present at a high frequency in feces and forensic specimens; furthermore, either B. uniformis or B. vulgatus was detected in all of the fecal and forensic specimens tested. Because the detection rate of B. uniformis and B. vulgatus was higher than that of B. thetaiotaomicron, these bacteria would be more appropriate for the detection of feces than would B. thetaiotaomicron. Bacteroides uniformis and B. thetaiotaomicron were not detected in other body samples, but B. vulgatus was detected in one of the six vaginal fluid samples. In a previous report, B. vulgatus and B. thetaiotaomicron were detected in the vaginal fluid of 1 of 13 healthy women [
[18]
], and B. thetaiotaomicron and B. uniformis were detected in 1.5 and 0.2%, respectively, of 1019 strains isolated from 239 vaginal discharges of patients in preterm labor [[19]
]. Therefore, detection of these bacteria may also indicate the presence of vaginal fluid. When the mixing of feces and vaginal fluid is suspected, an evaluation of the results obtained by this method should be carried out carefully, and whether these bacteria are present in the vaginal fluid should be confirmed. Also, these bacteria may exist to some extent in manure and sewage. Therefore, when samples are being collected the location needs to be considered, since it is possible that detection of these bacteria was a result of environmental contamination.In the present study, the discrimination of human fecal bacteria from that of other animals was not examined. Wang et al. [
[10]
] reported the detection of B. vulgatus and B. thetaiotaomicron in dog and cat feces. Therefore, this method cannot discriminate between the feces of humans and other animals. However, we can easily examine whether the fecal sample is derived from humans using the DNA fraction. The DNA fraction extracted from the fecal sample would contain human DNA if the fecal sample was human, and the method we describe here uses the same DNA extraction process as the human DNA typing test. Thus, although a few matters require further investigation, our results suggest that this molecular biological technique is able to detect the presence of feces in most forensic sample types.Recently, Giampaoli et al. [
[5]
] reported the discrimination of vaginal from various other body fluids by microbial signature detection using a multiplex real-time PCR assay. They used Enterococcus as the target fecal bacterium. However, this bacterial taxon would not be suitable for the identification of feces in forensic practice because Enterococcus can be detected in many vaginal samples. Consequently, Bacteroides, which is dominant in feces and isolated from other body fluids only rarely, should be used for the identification of feces. Also, our results suggest that the use of several Bacteroides species is critical. A comprehensive analysis using multiplex PCR is essential for forensic applications to discriminate feces from vaginal fluid. Further, the microbial signature of human body fluids should be exhaustively investigated by deeper analysis using high-throughput technology.In this study, we succeeded in developing an easy method for the detection of feces in forensic practice by determining the presence of human intestinal bacteria, more specifically, Bacteroides. Also, we previously reported the identification of saliva by the detection of oral bacteria using molecular biological techniques [
2
, 3
]. Recently, identification of the person who touched a keyboard was performed by analyzing the presence of different skin flora using meta-genomic analysis [[20]
]. Further, an analysis of soil flora using terminal restriction fragment length polymorphisms has been applied to the forensic identification of soil [21
, 22
]. Thus, the microbial flora represents an important clue for forensic science investigations. In the near future, such basic knowledge will be valuable for forensic examinations using novel molecular biological techniques and bioinformatics [[23]
].References
- Discrimination of animal species by analysis of mammalian fecal steroids.EISEI KAGAKU. 1986; 32: 114-122
- A novel method for the identification of saliva by detecting oral streptococci using PCR.J. Forensic Sci. Int. 2009; : 20-23
- A simple identification method of saliva by detecting Streptococcus salivarius using loop-mediated isothermal amplification.J. Forensic Sci. 2011; 56: S158-S161
- The use of bacteria for the identification of vaginal secretions.J. Forensic Sci. Int. Genet. 2010; 4: 311-315
- Molecular identification of vaginal fluid by microbial signature.J. Forensic Sci. Int. Genet. 2012; 6: 559-564
- Chaudhry R. Sharma N. Liu D. Molecular detection of human bacterial pathogens. CRC Press Inc, Boca Raton, FL2011: 491-494
- Gut flora in health and disease.Lancet. 2003; 361: 512-519
- Bacteroides and Fusobacterium.in: Davis B.D. Dulbecco R. Eisen H.N. Ginsberg H.S. Microbiology. 4th ed. J.B. Lippincott Company, Philadelphia1990: 589
- Design and evaluation of Bacteroides DNA probes for the specific detection of human fecal pollution.Appl. Environ. Microbiol. 1995; 61: 1171-1179
- PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples.Appl. Environ. Microbiol. 1996; 62: 1242-1247
- Specificity of a Bacteroides thetaiotaomicron marker for human feces.Appl. Environ. Microbiol. 2005; 71: 4945-4949
- Development of Bacteroides 16S rRNA gene TaqMan-based real-time PCR assays for estimation of total, human, and bovine fecal pollution in water.Appl. Environ. Microbiol. 2006; 72: 4214-4224
- 16S rRNA-based for quantitative detection of universal, human-, cow-, and dog-specific fecal Bacteroidales: a Bayesian approach.Water Res. 2007; 41: 3701-3715
- Use of a Bacteroides thetaiotaomicron-specific α-1-6, mannanase quantitative PCR to detect human faecal pollution in water.J. Appl. Microbiol. 2008; 105: 1686-1693
- Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.J. Microbiol. Methods. 2010; 82: 311-318
- Escherichia coli, enterococci, and Bacteroides thetaiotaomicron qPCR signals through wastewater and septage treatment.Water Res. 2011; 45: 2561-2572
- Mucosa-associated bacterial flora of the human colon.J. Med. Microbiol. 1997; 46: 85-91
- The isolation and identification of Bacteroides spp. from the normal human vaginal flora.J. Med. Microbiol. 1980; 13: 79-87
- Bacterial isolates from patients with preterm labor with and without preterm rupture of the fetal membranes.Infect. Dis. Obstet. Gynecol. 1999; 7: 190-194
- Forensic identification using skin bacterial communities.Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 6477-6481
- Statistical data analysis of bacterial t-RFLP profiles in forensic soil comparisons.Forensic Sci. Int. 2011; 210: 96-101
- Discrimination of soils at regional and local levels using bacterial and fungal t-RFLP profiling.J. Forensic Sci. 2011; 56: 61-69
- Detection of diverse aquatic microbes in blood and organs of drowning victims: first metagenomic approach using high-throughput 454-pyrosequencing.Forensic Sci. Int. 2012; 220: 135-146
Article info
Publication history
Published online: October 16, 2012
Accepted:
September 24,
2012
Received in revised form:
August 18,
2012
Received:
April 28,
2012
Identification
Copyright
© 2012 Elsevier Ireland Ltd. Published by Elsevier Inc. All rights reserved.
